Other pages & sections of our site:
[Home]  [Y-DNA]   [Contacts   [Groups]  [Haplogroups[Trees]  [Project Blog]  [Special]   [FAQ]

On this page:

 

Taylor Haplogroup R1b

This page is about the Y chromosome haplogroup R1b. Its purpose is to explain the genealogical and anthropological meanings of the determination. Also see this page about both R1a and R1b.

For a good graphic tree, click here.

Pertinent to the Taylor surname is that some form of R1b was carried to the British Isles by virtually every group to immigrate there after the Stone Age. They included Celts, Romans, Anglo-Saxons, and Vikings. Further, they seem to have all carried R1b1a2 (R-M269). Stone Age Britons may have been haplogroup E, G or other.

Haplogroup R1b (shorthand, R-M343), and specifically its R-M269 subclade, is the most common haplogroup in the British Isles -- more than 70% of all men and, in some regions, up to 90%. It has a similar frequency in the Taylor Family Genes Project (70%). If you are R1b and your paternal ancestry is European, the chances are good (50 to 1) that you are also in the R1b1a2 subclade; the page about that sub-clade is here.

Other forms of R1b are more common in Africa and Asia.

We have more than 140 presently unmatched members in Hg R1b. We are working to find matches and group these members.

Haplogroup R1b also includes the Western Atlantic Modal haplotype (WAMH). Separate pages list members who:

Members

As of this writing, Taylor Family Genes has >400 members in this haplogroup, about 70% of the total membership with yDNA results.

Almost all -- 98% -- of R1b Taylor Family Genes members are in the R1b1a2 (R-M269) subclade. (The few not R-M269 are from older versions of SNP tests which didn't include this SNP; current testing would likely find them M269+.) Of those, 50 have tested SNPs for subclades of R1b1a2 and all have been found to be R1b1a2a1a (R-P310). Also, there is this from ISOGG:

"Haplogroup R1b1a2-M269 is observed most frequently in Europe, especially western Europe, but with notable frequency in southwest Asia... The Atlantic Modal Haplotype, or AMH, is the most common STR haplotype in haplogroup R1b1a2a1a1-L11/S127 and most European R1b1a2 belongs to haplogroups R1b1a2a1a1a-S21/U106 or R1b1a2a1a1b-P312/S116."

As nearly as we can tell, given the difficulty of the data, about two-thirds of R1b Taylors are in the R-P312 subclade and one-third in R-U106. A major clue is the 66th FTDNA marker, DYS492; a value of 13 or more is 96% likely to be U106+; 12 or less is 95% likely to be P312+. Both of these subclades fathered subclade children of their own.

About this Haplogroup

Haplogroup R1b is believed to have originated 25 to 20 kya in West Asia. Its defining SNP is M343.

M343 is characterized by a change in the base pair at postion 402 with 424 base pairs, in which a cytosine (C) changes to an adenine (A). The forward sequence is "tttaacctcctccagctctgca" and backward is  "acccccacatatctccagg". See https://en.wikipedia.org/wiki/List_of_yDNA_single-nucleotide_polymorphisms

R1b is most frequent today in Western Europe (as R1b1a2 or R-M269) and parts of Sub-Saharan Central Africa (as R1b1c or
R-V88).

The R1b haplogroup is a branch of the macro-group R; the other main variants are R1a (found mostly in central and eastern Europe) and R2 (found mainly in South Asia). R is believed to have originated 23-40 kya  (thousands of years ago) and R1b on the order of 20 kya..

R1b has recently undergone a major reclassification of its sub-clades and we expect more to come.  FTDNA classifications reflect subdivisions as agreed by the Y Chromosome Consortium in 2010, but perhaps not the the 2015 classifications by ISOGG.

Note: As of 2015, FTDNA is using a hybrid tree -- the 2010 YCC plus its own additions. This hybrid places some subclades that ISOGG hasn't yet.

R1b with no subsequent mutations is rare; most people in this haplogroup will fall into one of the sub-clades (R1b1a, R1b1b or R1b1c) with further testing; all share the SNP mutation known as M343. A common haplotype is the Atlantic Modal Haplotype (or haplotype 15), corresponding to subclade R1b1b2a1a.

Haplogroup projects

Members of this haplogroup may want to consider joining the DNA project for it. See http://www.familytreedna.com/public/r1b/ or one of those listed at http://www.isogg.org/wiki/yDNA_haplogroup_projects, The more specific the project, the more it will be focused on informaitn applicable to you.

Highest frequencies

Atlantic Europe:
Irish 93%, Basques 92%, Welsh 86%, Northern Portuguese 80%, Scottish 77%, English 75%, Belgians 70%, Spanish 65%, Dutch 65%, Southern Portuguese 60%, Bashkirs 55%, German 45%, Hausa 40%, Czechs and Slovaks 36%,  Italian 36%,

Others: Armenians 36%, Turkmens 35%, Chad 20-35% and Hazara 32%, Chadic speakers.


Graphic from Wikipedia, created by user Crates, used in accord with the license. (No copying for commercial use.)

Notice the wide light-red swath (15% frequency) running from the Baltic in the north to central Asia in the southeast.

The darker red (25%) runs from Scandinavia also to Central Asia.

Next darker (40%) includes Iceland.& runs from western Scandinavia to northern Italy. 

The 50% swath runs through central Germany & France into the Iberian Peninsula.

The 80% (darkest red) swath includes northern Iberia (Spain & Portugal) , western France, Germany, and the British Isles.

The reader is advised to visit the information on Wikipedia and also Eupedia.  

Origins & Spread

Although R1b has come to dominate western Europe, it didn't originate there. The ancient ancestors  of the 110 million R1b1a2 (R-M269) European men migrated to there from elsewhere.

A paper presented by Dr. Michael Hammer in November 2013 reviewed the yDNA of 32 ancient males burials in Germany, Austria, France and Spain-- ranging from 5 to 7 kya. Of these, 27 (84%) were haplogroup G2a, 2 were F, 2 were I2a and 1 was E1b. None were R1b, supporting a hypothesis that R-M269 and its derivations entered Europe after the Neolithic period. Local epicenters of the  subclades were established; U106, U152 and L21 spread from those centers.

However, in May 2016, Nature published an article which, among other findings, classified the Y haplogroup of a 14,000 year old skeleton from Villabruna in northern Italy's Dolomite mountains.
"We were surprised to find haplogroup R1b in the ~14,000-year-old Villabruna individual from Italy. While the predominance of R1b in western Europe today owes its origin to Bronze Age migrations from the eastern European steppe, its presence in Villabruna and in a ~7,000-year-old farmer from Iberia documents a deeper history of this haplotype {haplogroup} in more western parts of Europe.
Additional evidence of an early link between West and East comes from the HERC2 locus, where a derived allele that is the primary driver of light eye colour in Europeans appears nearly simultaneously in specimens from Italy and the Caucasus ~14,000–13,000 years ago."

In short, there was at least one R1b man in northern Italy during the Ice Age 14 kya. Another article describes him more fully: Physical characteristics (over-development of one arm) and isotope analysis suggest a hunting lifestyle. Dental wear suggests he processed plant material into fibers. And, there was an R1b man in Spain, 7 kya. Both pre-date the Bronze Age mass intrusion of R1b into western Europe. These two instance, though, do not refute the accepted theory that R1b was not dominant in Europe before the Bronze Age.

Rib may have developed in the northern part of the Middle East or on the steppes of the Caucasus during the Ice Age and is associated with the spread of Indo-European languages, farming and bronze tools and weapons. During the early Neolithic Age, R1b men crossed over from present-day Turkey to the Pontic-Caspian steppe and made the transition from the Stone Age to the Bronze Age. They were first to domesticate horses,  ~4,000 BC, and work bronze. Their horses and bronze weapons gave them a military and reproductive advantage in westward expansion over the older peoples of western Europe. Their Indo-European based languages came to replace the older languages of the Cro-Magnon peoples.

According to Kylosov and Tomezzoli, {paragraphing added}

diagram of R1b1a2 split into U106 & P312

Two Predominant Branches

Two branches predominate (98%+) among Taylors. They are

U106 vs. P312

It may be possible to predict with some reliability from STR marker values which of the two branches (U106 vs. P312) you're in. See this section.

These subclades have their sub-subclades and sub-sub-subclades. Because the phylogenetic names get so long, we'll use the shorthand names:

Origins

In contrast to Hammer's more widely-accepted hypothesis, Kylosov and Tomezzoli, theorized that the subclades R-U106 & P312 (98% of R1b Taylors) arose on the Iberian peninsula about 4.8 kya. We don't argue for one or the other.

See the excellent maps and discussion at Eupedia.

yDNA Values

We do not publish individual members' yDNA results. They may be viewed on the Family Tree DNA public site,  http://www.familytreedna.com/public/taylorfamilygenes/default.aspx?section=yresults

However, sme STR values may be useful for predicting which subclade of R1b you're in.

Predicting Subclades from STR Markers

R1b example

Of the R1b men in the project, 98% are predicted from STR values or confirmed by SNP testing to be R1b1a2 (shorthand, R-M269). The two predominant branches of R-M269 are

In other words, if your Y-chromosome is R1b of European origin, you are almost certain to be R-M269 and either R-U106 or R-P312. How to tell which?

Most STR markers are of little use to distinguish between these two subclades aid only a few help.

The best of these is DYS492 (#66 in the FTDNA panels); it shows a sharp distinction with little crossover; 95% of P312 men have DYS492 <= 12 and 96% of U106 have DYS492 >= 13.

If you have DYS492 <= 12, the odds are 20:1 that you are P312+; if DYS492 >= 13, the odds are 20:1 that you are U106+.
 

DYS390 (FTDNA #2) is moderately useful; 58% of U106 men have DYS390 <= 23, while 89% of P312 men have DYS390 >= 24.

DYS576 shows some distinction between U106 & P312; a problem is that DYS576 = 18 is almost equally likely to be in either subclade.
 

CDYa (#29, the smallest value of CDY copies) has some distinguishing power. But, as the most volatile of all the markers, it shows considerable crossover between U106 & P312.
 

For your particular value at one of these markers, take the relative lengths of the bars in the graph as an indicator of which subclade you're likely to belong to. However, this can not be as definitive as actually testing for the SNPs.

Source: ISOGG Wiki

SNP Testing

The definitive way to establish one's Y-haplogroup is by testing SNPs (single nucleotide polymorphisms). A positive result for a SNP establishes that one belongs to the relevant haplogroup/sub-clade and any upstream; negative results establish haplogroups to which one does not belong and those downstream.

SNP Packs

In August 2015, FTDNA rolled out a product it calls the "R1b Backbone Panel", including 142 SNPs. The cost per SNP is less than $1. We believe it is a cost-effective means to establish haplogroups within R1b to reasonably fine precision.

FTDNA followed up by introducing subsidiary SNP Packs, to refine haplogroup classifications even further; each one also contain ~100 SNPs at about $1 per SNP. The strategy we recommend is to begin with the R1b Backbone Panel; its furthest downstream positive SNP will point toward the next SNP Pack to order.

FTDNA refers to the furthest downstream positive SNP as a "terminal SNP" and will post it to your results pages. It is not necessarily the furthest downstream SNP for which one would be positive if tested.

A comprehensive panel will include many SNPs for which one will test negative. In the diagram one the right, the green line traces the SNPs for which one might trace positive (+). The red lines represent the rest -- for which one would test negative (-). Focus on the positive SNPs; they tell you what you are. Negative SNPs tell you only what you are not.

YSEQ, a separate company, also offers similar panels. 

Next-Generation Sequencing (NGS)

This advanced method for testing SNPs is much more comprehensive than SNP Packs. Millions of Y-chromosome positions where SNPs may exist  are read at once. FTDNA calls its version "The Big Y" and the typical price is $575.

Reading the results of a NGS test can be like trying to drink from a fire hose; there is so much data and much of it has not been classified for interpretation. We recommend this test only for the experienced and motivated; advanced DNA knowledge (and perhaps extensive analysis) is required to make sense of the test results.

NGS tests, like Big Y and others, are leading to new discoveries (many by citizen scientists) and advancing knowledg.


Go to Top

Revised: 20 Jul 2016